Bio Chemistry
In Situ TEM – the New Frontier for Liquid Chemistry

To view the Mandarin version of this webinar, please click here.

Register for this webinar by logging in or signing up below.
Only a few decades ago, imaging liquids in the TEM was thought to be impossible.
Now, researchers are using in situ liquid cell holders like Poseidon Select to conduct unprecedented experiments in real, wet environments. Further, with increasing technical capabilities, better performance, and a more user friendly interface, in situ tools are becoming more accessible to researchers in all disciplines. In this webinar, researchers Saso Sturm and Layla Mehdi will present some of their recent work using the liquid heating and electrochemistry capabilities of the Protochips Poseidon Select holder.
In the field of functional nanomaterials, the early stage nucleation and growth phenomenon can largely govern the morphology and size distribution of nanoparticles nucleated from solution. However, the mechanisms controlling this phenomenon are unclear as direct observation of these processes was not possible with previous techniques. Dr. Sturm’s research successfully imaged the nucleation and growth of yttria precursors by urea precipitation in real time within the TEM. He will discuss his findings and the implications for future research during his presentation in this webinar.
Dr. Mehdi will present her recent results in the field of electrochemistry and battery applications using liquid cell in situ TEM. She used the electrical controls within Poseidon Select to charge and discharge nanoscale batteries immersed in liquid electrolytes, gaining new insight into the underlying reaction mechanisms.
The simultaneous acquisition of precise electrical data and real time imaging presents extraordinary opportunities for direct observation of electrochemical reactions at the nanoscale. The presentation will conclude with a brief synopsis and overview of Poseidon Select and other in situ holders from Protochips by Applications Scientist Madeline Dukes.
- Learn about electrochemistry and functional nanomaterials from leading researchers in the fields.
- Discover how in situ TEM has led to breakthroughs in battery research.
- Glimpse why there is still so much to discover about the thermodynamics and kinetics of suspended nanomaterials.
- Discover the powerful capabilities of liquid heating and electrochemistry in the TEM.
- Find out how Poseidon Select is redefining the capabilities of in situ liquid TEM.
Speakers:
Saso Sturm, Senior Researcher, Jozef Stefan Institute, Department of Nanostructured Materials.
Layla Mehdi, Post Doctorate RA B, Pacific Northwest National Laboratory, Chemical Physics and Analysis.
Madeline Dukes, Application Scientist, Protochips.
Joe d'Angelo, (Moderator), Materials Science Publisher, Elsevier.
When you register for this webinar your registration details will be passed to the sponsor who will provide you with information relevant to this topic.

To view the Mandarin version of this webinar, please click here.

Register for this webinar by logging in or signing up below.
Only a few decades ago, imaging liquids in the TEM was thought to be impossible.
Now, researchers are using in situ liquid cell holders like Poseidon Select to conduct unprecedented experiments in real, wet environments. Further, with increasing technical capabilities, better performance, and a more user friendly interface, in situ tools are becoming more accessible to researchers in all disciplines. In this webinar, researchers Saso Sturm and Layla Mehdi will present some of their recent work using the liquid heating and electrochemistry capabilities of the Protochips Poseidon Select holder.
In the field of functional nanomaterials, the early stage nucleation and growth phenomenon can largely govern the morphology and size distribution of nanoparticles nucleated from solution. However, the mechanisms controlling this phenomenon are unclear as direct observation of these processes was not possible with previous techniques. Dr. Sturm’s research successfully imaged the nucleation and growth of yttria precursors by urea precipitation in real time within the TEM. He will discuss his findings and the implications for future research during his presentation in this webinar.
Dr. Mehdi will present her recent results in the field of electrochemistry and battery applications using liquid cell in situ TEM. She used the electrical controls within Poseidon Select to charge and discharge nanoscale batteries immersed in liquid electrolytes, gaining new insight into the underlying reaction mechanisms.
The simultaneous acquisition of precise electrical data and real time imaging presents extraordinary opportunities for direct observation of electrochemical reactions at the nanoscale. The presentation will conclude with a brief synopsis and overview of Poseidon Select and other in situ holders from Protochips by Applications Scientist Madeline Dukes.
- Learn about electrochemistry and functional nanomaterials from leading researchers in the fields.
- Discover how in situ TEM has led to breakthroughs in battery research.
- Glimpse why there is still so much to discover about the thermodynamics and kinetics of suspended nanomaterials.
- Discover the powerful capabilities of liquid heating and electrochemistry in the TEM.
- Find out how Poseidon Select is redefining the capabilities of in situ liquid TEM.
Speakers:
Saso Sturm, Senior Researcher, Jozef Stefan Institute, Department of Nanostructured Materials.
Layla Mehdi, Post Doctorate RA B, Pacific Northwest National Laboratory, Chemical Physics and Analysis.
Madeline Dukes, Application Scientist, Protochips.
Joe d’Angelo, (Moderator), Materials Science Publisher, Elsevier.
When you register for this webinar your registration details will be passed to the sponsor who will provide you with information relevant to this topic.
Bio Chemistry
Structures of the glucocorticoid-bound adhesion receptor GPR97–Go complex

No statistical methods were used to predetermine sample size. The experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessment.
Cell lines
HEK293 cells were obtained from the Cell Resource Center of Shanghai Institute for Biological Sciences (Chinese Academy of Sciences). Spodoptera frugiperda (Sf9) cells were purchased from Expression Systems (cat. 94-001S). Y-1 cells were originally obtained from the American Type Culture Collection (ATCC). The cells were grown in monolayer culture in RPMI 1640 with 10% FBS (Gibco) at 37 °C in a humidified atmosphere consisting of 5% CO2 and 95% air.
Constructs of GPR97 and miniGo heterotrimer
For protein production in insect cells, the human GPR97 (residues 21–549) with the autoproteolysis motif mutation (H248/A and T250/A) was sub-cloned into the pFastBac1 vector. The native signal peptide was replaced with the haemagglutinin signal peptide (HA) to enhance receptor expression, followed by a Flag tag DYKDDDK (China peptide) to facilitate complex purification. An engineered human Gαo1 with Gαo1 H domain deletion, named miniGαo1 was cloned into pFastBac1 according to published literature29. Human Gβ1 with the C-terminal hexa-histidine tag and human Gγ2 were subcloned into the pFastBacDual vector. scFv16 was cloned into pfastBac1 with the C-terminal hexa-histidine tag and the N-terminal GP67 signal peptide. To examine the activities of GPR97, the GPR97-FL-WT (wild-type full-length GPR97), GPR97-FL-AA (GPR97 GPS site mutation, H248/A and T250/A), GPR97β (GPR97 with the NTF removed, residues 250–549) and GPR97-β-T (GPR97β with the N-terminal tethered Stachel sequence removed, residues 265–549) were sub-cloned into the pcDNA3.1 plasmid. The GPR97 mutations E298A, R299A, F345A, F353A, H362A, L363A, Y364A, V370A, F371A, Y406A, W421A, W490A, A493G, I494A, L498A and N510A were generated using the Quikchange mutagenesis kit (Stratagene). The G protein BRET probes were constructed according to previous publications42,43. Human G protein subunits (Gαq, Gβ1 and Gγ2) were sub-cloned into the pcDNA3.1 expression vectors. The Gαq-RlucII subunit was generated by amplifying and inserting the coding sequence of RlucII into Gαq between residue L97 and K98. The Gqo probe, in which the six amino acids of the C-terminal of Gαq-RlucII were substituted with those from Gαo1, was constructed by PCR amplification using synthesized oligonucleotides encoding swapped C-terminal sequences. The GFP10–Gγ2 plasmid was generated by fusing the GFP10 coding sequence in frame at the N terminus to Gγ2. All of the constructs and mutations were verified by DNA sequencing.
Protein expression
High titre recombinant baculoviruses were generated using Bac-to-Bac Baculovirus Expression System. In brief, 2 μg of recombinant bacmid and 2 μl X-tremGENE HP transfection reagent (Roche) in 100 μl Opti-MEM medium (Gibco) were mixed and incubated for 20 min at room temperature. The transfection solution was added to 2.5 ml Sf9 cells with a density of 1 × 106 per ml in a 24-well plate. The infected cells were cultured in a shaker at 27 °C for 4 days. P0 virus was collected and then amplified to generate P1 virus. The viral titres were determined by flow cytometric analysis of cells stained with gp64-PE antibody (1:200 dilution; 12-6991-82, Thermo Fisher). Then, Sf9 cells were infected with viruses encoding GPR97-FL-AA, miniGαo, Gβγ, and with or without scFv16, respectively, at equal multiplicity of infection. The infected cells were cultured at 27 °C, 110 rpm for 48 h before collection. Cells were finally collected by centrifugation and the cell pellets were stored at −80 °C.
GPR97–Go complex formation and purification
Cell pellets transfected with virus encompassing the GPR97-FL-AA, miniGo trimer and scFv16 (only existed in cell pellets for purifying the cortisol–GPR97-FL-AA–Go–scFv16 complex) were resuspended in 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 10 mM MgCl2 and 5 mM CaCl2 supplemented with Protease Inhibitor Cocktail (B14001, Bimake) and 100 μM TCEP (Thermo Fisher Scientific). The complex was formed for 2 h at room temperature by adding 10 μM BCM (HY-B1540, MedChemExpress) or cortisol (HY-N0583, MedChemExpress), 25 mU/ml apyrase (Sigma), and then solubilized by 0.5% (w/v) lauryl maltose neopentylglycol (LMNG; Anatrace) and 0.1% (w/v) cholesteryl hemisuccinate TRIS salt (CHS; Anatrace) for 2 h at 4 °C. Supernatant was collected by centrifugation at 30,000 rpm for 40 min, and the solubilized complex was incubated with nickel resin for 2 h at 4 °C. The resin was collected and washed with 20 column volumes of 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 25 mM imidazole, 0.01% (w/v) LMNG, 0.01% GDN (Anatrace), 0.004% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The complex was eluted with 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 200 mM imidazole, 0.01% (w/v) LMNG, 0.01% GDN, 0.004% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The elution of nickel resin was applied to M1 anti-Flag resin (Sigma) for 2 h and washed with 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 5 mM CaCl2, 0.01% (w/v) LMNG, 0.01% GDN, 0.004% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The GPR97–Go complex was eluted in buffer containing 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycerol, 2 mM MgCl2, 0.01% (w/v) LMNG, 0.01% GDN, 0.004% (w/v) CHS, 10 μM BCM (or cortisol), 100 μM TCEP, 5 mM EGTA and 0.2 mg/ml Flag peptide. The complex was concentrated and then injected onto Superdex 200 increase 10/300 GL column equilibrated in the buffer containing 20 mM HEPES, pH 7.4, 100 mM NaCl, 2 mM MgCl2, 0.00075% (w/v) LMNG, 0.00025% GDN, 0.0002% (w/v) CHS, 10 μM BCM (or cortisol) and 100 μM TCEP. The complex fractions were collected and concentrated individually for EM experiments.
Cryo-EM grid preparation and data collection
For the preparation of cryo-EM grids, 3 μl of purified BCM-bound and cortisol-bound GPR97–Go complex at approximately 20 mg/ml was applied onto a glow-discharged holey carbon grid (Quantifoil R1.2/1.3). Grids were plunge-frozen in liquid ethane cooled by liquid nitrogen using Vitrobot Mark IV (Thermo Fisher Scientific). Cryo-EM imaging was performed on a Titan Krios at 300 kV accelerating voltage in the Center of Cryo-Electron Microscopy, Zhejiang University. Micrographs were recorded using a Gatan K2 Summit direct electron detector in counting mode with a nominal magnification of ×29,000, which corresponds to a pixel size of 1.014 Å. Movies were obtained using serialEM at a dose rate of about 7.8 electrons per Å2 per second with a defocus ranging from −0.5 to −2.5 μm. The total exposure time was 8 s and intermediate frames were recorded in 0.2-s intervals, resulting in an accumulated dose of 62 electrons per Å2 and a total of 40 frames per micrograph. A total of 2,707 and 5,871 movies were collected for the BCM-bound and cortisol-bound GPR97–Go complex, respectively.
Cryo-EM data processing
Dose-fractionated image stacks for the BCM–GPR97–Go complex were subjected to beam-induced motion correction using MotionCor2.144. Contrast transfer function (CTF) parameters for each non-dose-weighted micrograph were determined by Gctf45. Particle selection, 2D and 3D classifications of the BCM–GPR97–Go complex were performed on a binned data set with a pixel size of 2.028 Å using RELION-3.0-beta246.
For the BCM–GPR97–Go complex, semi-automated particle selection yielded 2,026,926 particle projections. The projections were subjected to reference-free 2D classification to discard particles in poorly defined classes, producing 911,519 particle projections for further processing. The map of the 5-HT1BR–miniGo complex (EMDB-4358)47 low-pass filtered to 40 Å was used as a reference model for maximum-likelihood-based 3D classification, resulting in one well-defined subset with 307,700 projections. Further 3D classifications focusing the alignment on the complex produced two good subsets that accounted for 166,116 particles, which were subsequently subjected to 3D refinement, CTF refinement and Bayesian polishing. The final refinement generated a map with an indicated global resolution of 3.1 Å at a Fourier shell correlation of 0.143.
For the cortisol–GPR97–Go complex, particle selection yielded 4,323,518 particle projections for reference-free 2D classification. The well-defined classes with 2,201,933 particle projections were selected for a further two rounds of 3D classification using the map of the BCM-bound complex as reference. One good subset that accounted for 335,552 particle projections was selected for a further two rounds of 3D classifications that focused the alignment on the complex, and produced one high-quality subset with 75,814 particle projections. The final particle projections were subsequently subjected to 3D refinement, CTF refinement and Bayesian polishing, which generates a map with a global resolution of 2.9 Å. Local resolution for both density maps was determined using the Bsoft package with half maps as input maps48.
Model building and refinement
For the structure of the BCM–GPR97–Go complex, the initial template of GPR97 was generated using the module ‘map to model’ in PHENIX44. The coordinate of the 5-HT1BR–Go complex (PDB ID: 6G79) was used to generate the initial models for Go (ref. 44). Models were docked into the EM density map using UCSF Chimera49, followed by iterative manual rebuilding in COOT50 according to side-chain densities. BCM and lipid coordinates and geometry restraints were generated using phenix.elbow. BCM was built to the model using the ‘LigandFit’ module in PHENIX. The placement of BCM shows a correlation coefficient of 0.81, indicating a good ligand fit to the density. The model was further subjected to real-space refinement using Rosetta51 and PHENIX44.
For the structure of the cortisol–GPR97–Go complex, the coordinates of GPR97 and Go from the BCM-bound complex and scFv16 from the human NTSR1–Gi1 complex (PDB ID: 6OS9) were used as initial model. Models were docked into the density map and then were manual rebuilt in COOT. The agonist cortisol was built to the model using the ‘LigandFit’ module as described, showing a good density fit with a correlation coefficient of 0.80. The model was further refined using Rosetta51 and PHENIX44. The final refinement statistics for both structures were validated using the module ‘comprehensive validation (cryo-EM)’ in PHENIX44. The goodness of the fit of the model to the map was performed for both structures using a global model-versus-map FSC (Extended Data Fig. 2). The refinement statistics are provided in Extended Data Table 1. Figures of the structures were generated using UCSF Chimera, UCSF ChimeraX52 and PyMOL53.
Molecular dynamics simulation of the BCM–GPR97 and cortisol–GPR97 complexes
On the basis of the favour binding poses of BCM and cortisol with the receptor GPR97, which was calculated by the LigandFit program of PHENIX, the GPR97–agonist complexes were substrate from the two GPR97–agonist–mGo complexes for molecular dynamics simulation. The orientations of receptors were calculated by the Orientations of Proteins in Membranes (OPM) database. Following this, the whole systems were prepared by the CHARM-GUI and embedded in a bilayer that consisted of 200 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) lipids by replacement methods. The membrane systems were then solvated into a periodic TIP3P water box supplemented with 0.15 M NaCl. The CHARMM36m Force Filed was used to model protein molecules, CHARMM36 Force Filed for lipids and salt with CHARMM General Force Field (CGenFF) for the agonist molecules BCM and cortisol.
Then, the system was subjected to minimization for 10,000 steps using the conjugated gradient algorithm and then heated and equilibrated at 310.13 K and 1 atm for 200 ps with 10.0 kcal mol−1 Å−2 harmonic restraints in the NAMD 2.13 software. Next followed five cycles of equilibration for 2 ns each at 310.13 K and 1 atm, for which the harmonic restraints were 5.0, 2.5, 1.0, 0.5 and 0.1 kcal mol−1 Å−2 in sequence.
Production simulations were run at 310.13 K and 1 atm in the NPT ensemble using the Langevin thermostat and Nose–Hoover method for 200 ns. Electrostatic interactions were calculated using the particle mesh Ewald (PME) method with a cut-off of 12 Å. Throughout the final stages of equilibration and production, 5.0 kcal mol−1 Å−2 harmonic restraints were placed on the residues of GPR97 that were within 5 Å of Go in the BCM (or cortisol)–GPR97–Go complex to ensure that the receptor remained in the active state in the absence of the G protein. Trajectories were visualized and analysed using Visual Molecular Dynamics (VMD, version 1.9.3)
cAMP ELISA detection in Y-1 cells
Y-1 cells were transfected with Gpr97 siRNA (si-97, GUGCAGGGAAUGUCUUUAA) or control siRNA (si-Con) for 48 h. After starvation for 12 h in serum-free medium, the cells were further stimulated with cortisone (8 nM), forskolin (5 μM) (Sigma-Aldrich) or control vehicle for 10 min. Then, cells were washed three times with pre-cooled PBS and resuspended in pre-cooled 0.1 N HCl containing 500 μM IBMX at a 1:5 ratio (w/v). The samples were neutralized with 1 N NaOH at a 1:10 ratio (v/v) after 10 min. The supernatants were collected after centrifugation of the samples at 600g for 10 min. The supernatants were then prepared for cAMP determination using the cAMP Parameter Assay Kit (R&D Systems) according to the manufacturer’s instruction. The Gpr97 expression level under various conditions were further confirmed using quantitative real-time PCR.
Corticosterone measurements
Mouse adrenocorticotoma cell line Y-1 cells were transfected with Gpr97 siRNA (si-97) or control siRNA (si-Con) for 48 h. Then, the cells were treated with serum-free medium for 12 h. After that, cortisone (16 nM) or ACTH (0.5 μM) were added to cells for 30 min. The supernatants of the cell culture medium were collected for measurements of corticosterone by ELISA according to the manufacturer’s instructions.
Quantitative real-time PCR
Total RNA of cells was extracted using a standard TRIzol RNA isolation method. The reverse transcription and PCR experiments were performed with the Revertra Ace qPCR RT Kit (TOYOBO FSQ-101) using 1.0 μg of each sample, according to the manufacturer’s protocols. The quantitative real-time PCR was conducted in the Light Cycler apparatus (Bio-Rad) using the FastStart Universal SYBR Green Master (Roche). The mRNA level was normalized to GAPDH in the same sample and then compared with the control. The forward and reverse primers for GPR97 used in the experiments were CAGTTTGGGACTGAGGGACC and GCCCACACTTGGTGAAACAC. The mRNA level of GAPDH was used as an internal control. The forward and reverse primers for GAPDH were GCCTTCCGTGTTCCTACC and GCCTGCTTCACCACCTTC.
cAMP inhibition assay
To measure the inhibitory effects on forskolin-induced cAMP accumulation of different GPR97 constructs or mutants in response to different ligands or constitutive activity, the GloSensor cAMP assay (Promega) was performed according to previous publications12,13. HEK293 cells were transiently co-transfected with the GloSensor and various versions of GPR97 or vehicle (pcDNA3.1) plasmids using PEI in six-well plates. After incubation at 37 °C for 24 h, transfected cells were seeded into 96-well plates with serum-free DMEM medium (Gibco) and incubated for another 24 h at 37 °C in a 5% CO2 atmosphere. Different ligands were dissolved in DMSO (Sigma) to a stock concentration of 10 mM and followed by serial dilution using PBS solution immediately before the ligand stimulation. The transfected cells were pre-incubated with 50 μl of serum-free DMEM medium containing GloSensor cAMP reagent (Promega). After incubation at 37 °C for 2 h, varying concentrations of ligands were added into each well and followed by the addition of forskolin to 1 μM. The luminescence intensity was examined on an EnVision multi-label microplate detector (Perkin Elmer).
The Gqo protein activation BRET assay
According to previous publications, the BCM dipropionate-induced GPR97 activity could be measured by chimeric Gqo protein assays25. The Gqo BRET probes were generated by replacing the six amino acids of the C-terminal of Gq-RlucII with those from GoA1, creating a chimeric Gqo-RlucII subunit47. GFP10 was connected to Gγ. The Gqo protein activation BRET assay was performed as previously described54. In brief, HEK293 cells were transiently co-transfected with control D2R and various GPR97 constructs, plasmids encoding the Gqo BRET probes, incubated at 37 °C in a 5% CO2 atmosphere for 48 h. Cells were washed twice with PBS, collected and resuspended in buffer containing 25 mM HEPES, pH 7.4, 140 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 12 mM NaHCO3, 5.6 mM d-glucose, 0.5 mM MgCl2 and 0.37 mM NaH2PO4. Cells that were dispensed into a 96-well microplate at a density of 5–8 × 104 cells per well were stimulated with different concentrations of ligands. BRET2 between RLucII and GFP10 was measured after the addition of the substrate coelenterazine 400a (5 μM, Interchim) (Cayman) using a Mithras LB940 multimode reader (Berthold Technologies). The BRET2 signal was calculated as the ratio of emission of GFP10 (510 nm) to RLucII (400 nm).
Measurement of receptor cell-surface expression by ELISA
To evaluate the expression level of wild-type GPR97 and its mutants, HEK293 cells were transiently transfected with wild-type and mutant GPR97 or vehicle (pcDNA3.1) using PEI regent at in six-well plates. After incubation at 37 °C for 18 h, transfected cells were plated into 24-well plates at a density of 105 cells per well and further incubated at 37 °C in a 5% CO2 atmosphere for 18 h. Cells were then fixed in 4% (w/v) paraformaldehyde and blocked with 5% (w/v) BSA at room temperature. Each well was incubated with 200 μl of monoclonal anti-FLAG (F1804, Sigma-Aldrich) primary antibody overnight at 4 °C and followed by incubation of a secondary goat anti-mouse antibody (A-21235, Thermo Fisher) conjugated to horseradish peroxide for 1 h at room temperature. After washing, 200 μl of 3,3′,5,5′-tetramethylbenzidine (TMB) solution was added. Reactions were quenched by adding an equal volume of 0.25 M HCl solution and the optical density at 450 nm was measured using the TECAN (Infinite M200 Pro NanoQuant) luminescence counter. For determination of the constitutive activities of different GPR97 constructs or mutants, varying concentrations of desired plasmids were transiently transfected into HEK293 cells and the absorbance at 450 nm was measured.
The FlAsH-BRET assay
HEK293 cells were seeded in six-well plates after transfection with GPR97-FlAsH with Nluc inserted in a specific N-terminal site. Before the BRET assay, HEK293 cells were starved with serum for 1 h. Then cells were digested, centrifuged and resuspended in 500 μl BRET buffer (25 mM HEPES, 1 mM CaCl2, 140 mM NaCl, 2.7 mM KCl, 0.9 mM MgCl2, 0.37 mM NaH2PO4, 5.5 mM d-glucose and 12 mM NaHCO3). The FlAsH-EDT2 was added at a final concentration of 2.5 μM and incubated at 37 °C for 60 min. Subsequently, HEK293 cells were washed with BRET buffer and then distributed into black-wall clear-bottom 96-well plates, with approximately 100,000 cells per well. The cells were treated with a final concentration of BCM and cortisol at 10−5 to 10−11 and then coelenterazinc H was added at a final concentration of 5 μM, followed by checking the luciferase (440–480 nm) and FlAsH (525–585 nm) emissions immediately. The BRET ratio (emission enhanced yellow fluorescent protein/emission Nluc) was calculated using a Berthold Technologies Tristar 3 LB 941 spectrofluorimeter. The procedure was modified from those described previously34,55,56.
Statistical analysis
A one-way ANOVA test was performed to evaluate the statistical significance between various versions of GPR97 and their mutant in terms of expression level, potency or efficacy using GraphPad Prism. For all experiments, the standard error of the mean of the values calculated based on the data sets from three independent experiments is shown in respective figure legends.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this paper.
Bio Chemistry
A ‘Build and Retrieve’ methodology to simultaneously solve cryo-EM structures of membrane proteins

Vinothkumar, K. R. & Henderson, R. Single particle electron cryomicroscopy: trends, issues and future perspective. Q. Rev. Biophys. 49, 1–25 (2016).
Herzik, M. A.Jr, Wu, M. & Lander, G. C. High-resolution structure determination of sub-100 kDa complexes using conventional cryo-EM. Nat. Commun. 10, 1032 (2019).
Ho, C. M. et al. Malaria parasite translocon structure and mechanism of effector export. Nature 561, 70–75 (2018).
Morgan, C. E. et al. Cryo-electron microscopy structure of the Acinetobacter baumannii 70S ribosome and implications for new antibiotic development. mBio 11, e03117–e03119 (2020).
Adams, P. D. et al. PHENIX: building new software for automated crystallographic structure determination. Acta Crystallogr. D Biol. Crystallogr. 58, 1948–1954 (2002).
Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126–2132 (2004).
Daligault, H. E. et al. Whole-genome assemblies of 56 Burkholderia species. Genome Announc. 2, e01106–e01114 (2014).
Doughty, D. M. et al. The RND-family transporter, HpnN, is required for hopanoid localization to the outer membrane of Rhodopseudomonas palustris TIE-1. Proc. Natl Acad. Sci. U S A 108, E1045–E1051 (2011).
Sousa, F. L. et al. The superfamily of heme-copper oxygen reductases: types and evolutionary considerations. Biochim. Biophys. Acta 1817, 629–637 (2012).
Abramson, J. et al. The structure of the ubiquinol oxidase from Escherichia coli and its ubiquinone binding site. Nat. Struct. Biol. 7, 910–917 (2000).
Yap, L. L. et al. The quinone-binding sites of the cytochrome bo3 ubiquinol oxidase from Escherichia coli. Biochim. Biophys. Acta 1797, 1924–1932 (2010).
Choi, S. K. et al. Location of the substrate binding site of the cytochrome bo3 ubiquinol oxidase from Escherichia coli. J. Am. Chem. Soc. 139, 8346–8354 (2017).
Kumar, N. et al. Crystal structures of the Burkholderia multivorans hopanoid transporter HpnN. Proc. Natl Acad. Sci. U S A 114, 6557–6562 (2017).
Centers for Disease Control and Prevention. Bioterrorism agents/diseases (U.S. Department of Health and Human Services, 2018); https://emergency.cdc.gov/agent/agentlist-category.asp
Wagar, E. Bioterrorism and the role of the clinical microbiology laboratory. Clin. Microbiol. Rev. 29, 175–189 (2016).
Christopher, G. W., Cieslak, T. J., Pavlin, J. A. & Eitzen, E. M.Jr Biological warfare. A historical perspective. JAMA 278, 412–417 (1997).
Nierman, W. C. et al. Structural flexibility in the Burkholderia mallei genome. Proc. Natl Acad. Sci. U S A 101, 14246–14251 (2004).
Schweizer, H. P. Mechanisms of antibiotic resistance in Burkholderia pseudomallei: implications for treatment of melioidosis. Future Microbiol. 7, 1389–1399 (2012).
Malott, R. J., Steen-Kinnaird, B. R., Lee, T. D. & Speert, D. P. Identification of hopanoid biosynthesis genes involved in polymyxin resistance in Burkholderia multivorans. Antimicrob. Agents Chemother. 56, 464–471 (2012).
Malott, R. J. et al. Fosmidomycin decreases membrane hopanoids and potentiates the effects of colistin on Burkholderia multivorans clinical isolates. Antimicrob. Agents Chemother. 58, 5211–5219 (2014).
Nikaido, H. Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol. Biol. Rev. 67, 593–656 (2003).
Cowan, S. W. et al. Crystal structures explain functional properties of two E. coli porins. Nature 358, 727–733 (1992).
Yankovskaya, V. et al. Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 299, 700–704 (2003).
Baslé, A., Rummel, G., Storici, P., Rosenbusch, J. P. & Schirmer, T. Crystal structure of osmoporin OmpC from E. coli at 2.0 Å. J. Mol. Biol. 362, 933–942 (2006).
Carpena, X., Melik-Adamyan, W., Loewen, P. C. & Fita, I. Structure of the C-terminal domain of the catalase–peroxidase KatG from Escherichia coli. Acta Crystallogr. D Biol. Crystallogr. 60, 1824–1832 (2004).
Capitani, G. et al. Crystal structure and functional analysis of Escherichia coli glutamate decarboxylase. EMBO J. 22, 4027–4037 (2003).
Chorev, D. S. et al. Protein assemblies ejected directly from native membranes yield complexes for mass spectrometry. Science 362, 829–834 (2018).
Ho, C. M. et al. Bottom-up structural proteomics: cryoEM of protein complexes enriched from the cellular milieu. Nat. Methods 17, 79–85 (2020).
Kastritis, P. L. et al. Capturing protein communities by structural proteomics in a thermophilic eukaryote. Mol. Syst. Biol. 13, 936 (2017).
Yi, X., Verbeke, E. J., Chang, Y., Dickinson, D. J. & Taylor, D. W. Electron microscopy snapshots of single particles from single cells. J. Biol. Chem. 294, 1602–1608 (2019).
Schmidli, C. et al. Microfluidic protein isolation and sample preparation for high-resolution cryo-EM. Proc. Natl Acad. Sci. U S A 116, 15007–15012 (2019).
Long, F. et al. Crystal structures of the CusA efflux pump suggest methionine-mediated metal transport. Nature 467, 484–488 (2010).
Mastronarde, D. N. Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. 152, 36–51 (2005).
Zheng, S. Q. et al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nat. Methods 14, 331–332 (2017).
Punjani, A., Rubinstein, J. L., Fleet, D. J. & Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods 14, 290–296 (2017).
Terwilliger, T. C., Ludtke, S. J., Read, R. J., Adams, P. D. & Afonine, P. V. Improvement of cryo-EM maps by density modification. Nat. Methods 17, 923–927 (2020).
Afonine, P. V. et al. Real-space refinement in PHENIX for cryo-EM and crystallography. Acta Crystallogr. D Struct. Biol. 74, 531–544 (2018).
Chen, V. B. et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr. D Biol. Crystallogr. 66, 12–21 (2010).
Marty, M. T. et al. Bayesian deconvolution of mass and ion mobility spectra: from binary interactions to polydisperse ensembles. Anal. Chem. 87, 4370–4376 (2015).
Shevchenko, A., Wilm, M., Vorm, O. & Mann, M. Mass spectrometric sequencing of proteins from silver-stained polyacrylamide gels. Anal. Chem. 68, 850–858 (1996).
Bio Chemistry
Glycoproteomics
Glycoproteomics is coming of age, thanks to advances in instrumentation, experimental methodologies and computational search algorithms.
Glycosylation is one of the most common post-translational modifications, and glycoproteins play crucial roles in important biological processes like cell signaling, host–pathogen interaction, immune response and disease, including cancer and even the ongoing COVID-19 pandemic (Science 369, 330–333, 2020). Glycoproteomics aims to determine the positions and identities of the complete repertoire of glycans and glycosylated proteins in a given cell or tissue.

Glycans are everywhere. High-throughput glycoproteomics approaches offer insights. Credit: Katherine Vicari, Springer Nature
Mass spectrometry (MS)-based approaches allow large-scale global analysis; however, the structural diversity of glycans and the heterogeneous nature of glycosylation sites make comprehensive analysis particularly challenging. Glycans obstruct complete fragmentation of the protein backbone, and they were traditionally removed for simplicity at the cost of losing glycan information. The MS spectra tend to be complicated due to the presence of isomers, often requiring manual interpretation. Furthermore, database searching for spectral matches can quickly become a combinatorial problem and requires innovative bioinformatics solutions.
Recent developments in MS instrumentation, fragmentation strategies (J. Proteome Res. 19, 3286–3301, 2020) and high-throughput workflows have made analyzing intact glycoproteins a possibility. Several specific enrichment strategies have made even low-abundance glycans and glycopeptides detectable (Mol. Cell. Proteomics https://doi.org/10.1074/mcp.R120.002277, 2020). A variety of experimental workflows tailored for either N-linked glycans, which are found at consensus sites on the proteins, or O-linked glycans, which have no recognizable consensus sequence, have been developed (Nature 549, 538–542, 2017; Nat. Commun. 11, 5268, 2020; Nat. Methods 16, 902–910, 2019). New software packages based on fragment-ion indexing strategies offer substantial increases in speed for glycopeptide and site assignments (Nat. Methods 17, 1125–1132, 2020; Nat. Methods 17, 1133–1138, 2020).
With other -omics fields taking the lion’s share of attention in recent years, it is now time for glycoproteomics to shine. Comprehensive understanding of glycosylation at different levels of granularity is bound to serve both basic and translational research.
Author information
Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Singh, A. Glycoproteomics. Nat Methods 18, 28 (2021). https://doi.org/10.1038/s41592-020-01028-9
-
Heartland1 week ago
CBD Oil for Dogs With Seizures: The Ultimate Guide
-
Heartland7 days ago
Florida Bill Aims to Legalize Medical Magic Mushrooms
-
Heartland1 day ago
CBD Vape Oil Market 2021: Global Trends, Business Overview, Challenges, Opportunities …
-
Heartland1 week ago
Delta 8: Shipping Vape Ban Goes Into Effect Soon – What Does It Means?
-
Heartland6 days ago
Explained: How CBD Oil is Different Than CBD Capsule?
-
Heartland1 week ago
Affordable cbd oil?
-
Heartland1 week ago
…
-
Material1 week ago
Dielectric properties and potential applications of alizarin yellow GG-Cu(II) complex film blended with polyvinyl alcohol