Suivez nous sur

Biochimie

La sous-unité δ et la NTPase HelD instituent un mécanisme à deux volets pour le recyclage de l'ARN polymérase

Réédité par Platon

En cliquant sur ce bouton,

on

Plasmides, ADN et ARN

Un fragment d'ADN codant Subtilis HelD a été amplifié par PCR à partir de la souche MH5636 (tableau supplémentaire 1). Le produit de PCR a été inséré dans le vecteur d'expression pGEX-6p-1 via BamHI et XhoI sites de restriction, en cadre avec une région codant pour une étiquette GST N-terminale. Fragments d'ADN codant Subtilis σA, δ ou δNTD ont été amplifiés par PCR à partir de la souche MH5636 et insérés dans un vecteur pETM-11 (EMBL, Heidelberg) via NcoI/De derrièreIII ou NcoI/ XhoI sites de restriction, respectivement, en cadre avec une région codant pour un His N-terminal6-marque. Les oligomères d'ADN et d'ARN utilisés pour l'assemblage de complexes de transcription ont été achetés respectivement auprès d'Eurofins et d'IBA Lifesciences.

Production et purification de protéines

Subtilis souches MH5636, LK782 (ΔTENU) ou LK1032 (ΔTENUΔrpoE; Tableau supplémentaire 1) ont été utilisées pour produire des RNAP en phase stationnaire, RNAPΔHelD ou RNAPΔδΔHelD, respectivement. Dans ces souches, la sous-unité β ′ codée chromosomiquement porte un His C-terminal10-marque. Les souches ont été cultivées dans du milieu TB à 37 ° C jusqu'à une DO600 de 1.0 et ont ensuite été déplacés à 18 ° C et cultivés jusqu'à une DO600 d'environ 11. Toutes les étapes de purification ont été effectuées à 4 ° C. Les cellules ont été récoltées par centrifugation, remises en suspension dans du tampon A (50 mM Na2HPO4, 300 mM de NaCl, 3 mM de 2-mercaptoéthanol, 5% [v / v] glycerol, pH 7.9), et lysé par sonication. Le lysat a été clarifié par centrifugation. Les variantes RNAP ont été capturées sur Ni2+-Résine d'affinité NTA (Macherey-Nagel), lavée avec du tampon A supplémenté avec 25 mM d'imidazole, et éluée avec du tampon A supplémenté avec 250 mM d'imidazole. L'éluat a été dialyse pendant une nuit contre 50 mM de Na2HPO4, 300 mM NaCl, 3 mM DTT, 5% [v / v] glycérol, pH 7.9, chargé sur une colonne HiTrap Heparin HP de 5 ml (GE Healthcare), lavé avec du tampon B (50 mM TRIS-HCl, 100 mM NaCl, 3 mM DTT, 0.1 mM EDTA, 5% [v / v] glycerol, pH 7.9) et élue avec un gradient linéaire vers le tampon B avec 700 mM de NaCl. Les fractions contenant les RNAP ont été regroupées et purifiées par SEC sur une colonne HiLoad Superdex 200 Augmentation 16/600 (GE Healthcare) dans 20 mM TRIS-HCl, 150 mM NaCl, 0.5 mM DTT, 5% (v / v) glycerol, pH 8.0 . Les échantillons finaux ont été concentrés à environ 16 mg / ml. Le RNAP produit à partir de la souche MH5636 a été directement utilisé pour la préparation d'échantillons EM. D'autres préparations de RNAP ont été aliquotées, surgelées dans du N liquide2, et conservé à -80 ° C.

Recombinant Subtilis GST-HelD a été produit en E. coli Cellules Rosetta (DE3), His6-δ, Son6NTD, et son6A ont été produits en E. coli Cellules BL21 (DE3) -RIL. Les cellules ont été cultivées dans des milieux auto-inducteurs59 à 37 ° C à une DO600 de 1.0 et incubé à 20 ° C pendant une nuit. Toutes les étapes de purification ont été effectuées à 4 ° C. Les cellules GST-HelD ont été récoltées par centrifugation, remises en suspension dans le tampon C (50 mM TRIS-HCl, 500 mM NaCl, 1 mM 2-mercaptoéthanol, 10% [v / v] glycerol, pH 7.9) et lysées par sonication. Le lysat a été clarifié par centrifugation, GST-HelD a été capturé sur résine de glutathion (Macherey-Nagel), lavé avec du tampon C et élué avec 50 mM TRIS-HCl, 300 mM NaCl, 1 mM DTT, 10% (v / v) glycérol, glutathion réduit 20 mM, pH 7.9. Les fractions éluées ont été dialysées contre le tampon D (TRIS-HCl 20 mM, NaCl 200 mM, DTT 1 mM, glycérol 5% [v / v], pH 7.9) en présence de protéase PreScission marquée par GST. HelD a été séparé de la protéine non clivée, de la GST et de la GST-PreScission par un second passage à travers la résine de glutathion. L'écoulement a été encore purifié par SEC sur une colonne HiLoad Superdex 200 Augmentation 16/600 équilibrée dans le tampon D.2, et conservé à -80 ° C.

Son6-δ ou His6NTD les cellules ont été récoltées par centrifugation, remises en suspension dans 50 mM de TRIS-HCl, 500 mM de NaCl, 0.5 mM de 2-mercaptoéthanol à 5% [v / v] glycerol, pH 6.0 et lysées par sonication. Le lysat a été clarifié par centrifugation, His6-δ / Son6NTD a été capturé sur Ni2+-NTA résine, lavée avec 50 mM TRIS-HCl, 300 mM NaCl, 0.5 mM 2-mercaptoéthanol, 10 mM imidazole, 5% (v / v) glycérol, pH 6.0, et éluée avec 20 mM TRIS-HCl, 150 mM NaCl , 0.5 mM de 2-mercaptoéthanol, 400 mM d'imidazole, 5% (v / v) de glycérol, pH 6.0. Pour l'assemblage de complexes pour l'analyse cryoEM, élue His6-δ a été supplémenté avec une protéase TEV marquée His (1:40 [w / w]), dialysé contre le tampon E (20 mM TRIS-HCl, 150 mM NaCl, 1 mM DTT, 5% (v / v) glycerol, pH 6.0) pendant une nuit et passé à travers Ni frais2+-NTA résine pour enlever le His non clivé6-δ, le sien clivé6-tag et protéase TEV marquée par His. Les protéines ont été davantage purifiées par SEC sur une colonne Superdex 75 Augmentation 10/300 (GE Healthcare) dans le tampon E. Fractions contenant His6-δ, δ ou His6NTD ont été concentrés à ~ 4 mg / ml (His6-δ, Son6NTD) et 23 mg / ml (δ), aliquotés, surgelés dans du N liquide2 et stocké à -80 ° C.

σA les cellules ont été récoltées par centrifugation, remises en suspension dans du tampon F (20 mM TRIS-HCl, 500 mM NaCl, 1 mM 2-mercaptoéthanol, 5% [v / v] glycerol, pH 7.5) supplémenté avec 20 mM d'imidazole et lysées par sonication. Le lysat a été clarifié par centrifugation, His6A a été capturé sur Ni2+-NTA résine, lavée avec du tampon F additionné d'imidazole 50 mM, et éluée avec du tampon F additionné d'imidazole 400 mM. Élué son6A a été supplémenté avec une protéase TEV marquée His (1:40 [w / w]), dialysé contre le tampon F supplémenté avec 1 mM d'EDTA pendant une nuit, et passé à travers Ni frais2+-NTA résine pour éliminer His non clivé6A, clivé Son6-tag et protéase TEV marquée His. La protéine cible a été davantage purifiée par SEC sur une colonne Superdex 75 Augmentation 16/600 (GE Healthcare) dans 25 mM de TRIS-HCl, 300 mM de NaCl, 0.1 mM de DTT, 5% (v / v) de glycérol, pH 7.5. Fractions contenant σA ont été concentrés à environ 39 mg / ml, aliquotés, congelés instantanément dans du N liquide2, et conservé à -80 ° C.

Réticulation / spectrométrie de masse

Le sulfo-SDA établit principalement des réticulations de la lysine-X à travers un groupement amine-réactif primaire d'un côté et un groupement activable aux UV de l'autre (limite de réticulation théorique 25 Â). Le sulfo-SDA a été préparé à 3 mg / ml dans 20 mM HEPES-NaOH, 5 mM Mg (OAc)2, 300 mM NaCl, 5 mM DTT, 5% (v / v) glycérol, pH 8.0 immédiatement avant l'ajout de RNAPΔδΔHelD, RNAPΔδΔHelD-δ, RNAPΔδΔHelD-HelD, ou RNAPΔδΔHelD-δ-HelD (protéine: sulfo-SDA 1: 3 [w / w]). Les échantillons ont été incubés sur de la glace pendant deux heures, puis irradiés dans un film mince en utilisant 365 nm UV (UVP CL-1000 UV Crosslinker, UVP Inc.) pendant 20 min sur de la glace (à 5 cm de distance de la lampe UV-A). Les échantillons réticulés ont été séparés par 4 à 12% de BIS-TRIS NuPAGE, les bandes de gel correspondant aux complexes monomères réticulés ont été excisées et digérées en gel60. Les peptides résultants ont été dessalés à l'aide de C18 StageTips61.

10% de chaque échantillon ont été analysés par LC-MS / MS sans fractionnement, les 90% restants ont été fractionnés en utilisant SEC sur une colonne Superdex Peptide 3.2 / 300 (GE Healthcare) dans 30% (v / v) d'acétonitrile, 0.1% (v / v) acide trifluoroacétique à un débit de 10 µl / min pour enrichir en peptides réticulés62. Les six premières fractions contenant le peptide (50 μl chacune) ont été collectées, le solvant a été éliminé à l'aide d'un concentrateur sous vide et les fractions ont été analysées par LC-MS / MS sur un spectromètre de masse Orbitrap Fusion Lumos Tribrid (ThermoFisher Scientific), connecté à un Système ultime 3000 RSLCnano (Dionex, ThermoFisher Scientific).

Les échantillons non fractionnés ont été injectés sur une colonne EASY-Spray C50 LC de 18 cm (ThermoFisher Scientific) fonctionnant à 50 ° C. Les peptides ont été séparés en utilisant un gradient linéaire allant de 2% de phase mobile B (80% [v / v] acétonitrile, 0.1% [v / v] acide formique) à 40% de phase mobile B en phase mobile A (0.1% [v / v] v] acide formique) à un débit de 0.3 μl / min sur 110 min, suivi d'une augmentation linéaire de 40 à 95% de phase mobile B en 11 min. Les peptides élués ont été ionisés par une source EASY-Spray (ThermoFisher Scientific) et les données MS ont été acquises en mode dépendant des données avec l'option de vitesse maximale. Pour chaque cycle d'acquisition de 3 s, le spectre de masse à balayage complet a été enregistré dans l'Orbitrap avec une résolution de 120,000 3. Les ions avec un état de charge de 7+ à 30+ ont été isolés et fragmentés en utilisant une dissociation collisionnelle à plus haute énergie (HCD) avec 50,000% d'énergie de collision. Les spectres de fragmentation ont ensuite été enregistrés dans l'Orbitrap avec une résolution de 60 XNUMX. L'exclusion dynamique a été activée avec un seul nombre de répétitions et une durée d'exclusion de XNUMX s.

Les fractions SEC ont été analysées en utilisant une configuration LC-MS / MS identique. Les peptides ont été séparés en appliquant un gradient allant de 2 à 45% de phase mobile B (optimisé pour chaque fraction) sur 90 min, suivi d'une montée en puissance de la phase mobile B à 55 et 95% en 2.5 min chacun. Pour chaque cycle d'acquisition MS de trois secondes dépendant des données, le spectre de masse à balayage complet a été enregistré dans l'Orbitrap avec une résolution de 120,000 3. Les ions avec un état de charge de 7+ à 26+ ont été isolés et fragmentés en utilisant HCD. Pour chaque précurseur isolé, l'un des trois paramètres d'énergie de collision (28%, 30% ou XNUMX%) a été sélectionné pour la fragmentation à l'aide d'un arbre de décision dépendant des données basé sur le m/z et charge du précurseur. Les spectres de fragmentation ont été enregistrés dans l'Orbitrap avec une résolution de 50,000 60. L'exclusion dynamique a été activée avec un seul nombre de répétitions et une durée d'exclusion de XNUMX s.

Les données LC-MS / MS générées à partir des quatre complexes ont été traitées séparément. Les listes de pics MS2 ont été générées à partir des fichiers de données MS brutes à l'aide du module MSConvert dans ProteoWizard (version 3.0.11729). Les paramètres par défaut ont été appliqués, sauf que Top MS / MS Peaks par 100 Da a été réglé sur 20 et la fonction de débruitage a été activée. Précurseur et fragment m/z les valeurs ont été recalibrées. L'identification des peptides réticulés a été réalisée à l'aide du logiciel xiSEARCH (https://www.rappsilberlab.org/software/xisearch; version 1.7.4)63. Pour RNAPΔδΔHelD, les listes de pics ont été recherchées par rapport à la séquence et à la séquence inversée des sous-unités RNAP (α, β, β ′ et ε) et de deux protéines co-purifiées, σA et σB. Pour RNAPΔδΔHelD-δ, RNAPΔδΔHelD-HelD et RNAPΔδΔHelDDes échantillons -δ-HelD, des séquences protéiques de δ, HelD ou les deux ont été inclus dans la base de données. Les paramètres suivants ont été appliqués pour la recherche: précision MS = 4 ppm; Précision MS2 = 8 ppm; enzyme = trypsine (avec une spécificité tryptique complète); nombre autorisé de clivages manqués = 2; pic monoisotopique manquant = 2; agent de réticulation = sulfo-SDA (la spécificité de la réaction pour le sulfo-SDA était supposée être pour la lysine, la sérine, la thréonine, la tyrosine et les extrémités N-protéines de la protéine à l'extrémité ester NHS, et tout résidu d'acide aminé pour l'extrémité diazirine); modifications fixes = carbamidométhylation sur cystéine; modifications variables = oxydation sur la liaison en boucle méthionine et sulfo-SDA. Les candidats peptidiques réticulés identifiés ont été filtrés en utilisant xiFDR64. Un taux de fausses découvertes de 5% au niveau des paires de résidus a été appliqué avec l'option «Boost entre» sélectionnée. Les paires de résidus réticulés identifiées à partir des quatre complexes sont résumées dans le tableau supplémentaire 4 et données supplémentaires 1.

Préparation, collecte et traitement des échantillons CryoEM

Des quantités équimolaires d'ADNt, d'ADN nt et d'ARN ont été mélangées dans le tampon G (20 mM TRIS-HOAc, 5 mM Mg [OAc]2, 100 mM KOAc, 2 mM DTT, 5% [v / v] glycerol, pH 8.0) et recuit par chauffage à 95 ° C pendant 5 min et refroidissement subséquent à 25 ° C à 1 ° C / min. L'échafaudage recuit a été incubé avec Subtilis RNAP dans un rapport molaire de 1.3: 1 dans le tampon H (20 mM TRIS-HOAc, 5 mM Mg [OAc]2, KOAc 300 mM, DTT 2 mM, glycérol 5% [v / v], pH 8.0) pendant 10 min sur de la glace, puis pendant 10 min à 32 ° C. Des quantités équimolaires (à RNAP) de δ et de HelD ont été ajoutées par étapes, suivies d'une incubation pendant 10 min à 32 ° C après chaque addition. Le mélange a été soumis à SEC sur une colonne Superdex 200 Augmentation 3.2 / 300 (GE Healthcare) dans le tampon H. Les fractions contenant RNAP, δ et HelD ont été réunies et concentrées à environ 5 mg / ml.

Immédiatement avant la préparation des grilles, l'échantillon a été complété avec 0.15% (p / v) n-octylglucoside (concentration micellaire critique 0.6% [p / v]). 3.8 pi du mélange final ont été déposés sur des grilles de carbone à trous Quantifoil R1 / 2 traitées au plasma à 10 ° C / 100% d'humidité et plongés dans de l'éthane liquide à l'aide d'un FEI Vitrobot Mark IV. L'acquisition d'image a été réalisée sur un microscope électronique à transmission FEI Titan Krios G3i (300 kV) avec une caméra Falcon 3EC à un grossissement nominal de 92,000 0.832x en mode de comptage en utilisant le logiciel EPU (ThermoFisher Scientific) avec une taille de pixel calibrée de 40 Å . Une dose d'électrons totale de XNUMX e-/UNE2 a été accumulé sur un temps d'exposition de 36 s. L'alignement du film a été réalisé avec MotionCor265 en utilisant des patchs 5 × 5 suivis d'une estimation ctf avec Gctf66.

Toutes les étapes d'analyse d'image suivantes ont été effectuées avec cryoSPARC67. Des moyennes de classe de particules sélectionnées manuellement ont été utilisées pour générer un modèle initial pour le prélèvement de particules basé sur la référence à partir de 9127 440 micrographies. Les images de particules ont été extraites avec une taille de boîte de 110 et regroupées à 3 pour l'analyse initiale. Une reconstruction ab initio utilisant un petit sous-ensemble de particules a été réalisée pour générer une référence 3D initiale pour le raffinement hétérogène 220D. L'ensemble de données a été classé itérativement en deux populations bien résolues représentant RNAP-δ-HelD monomère et dimère. Les particules sélectionnées ont été ré-extraites avec une boîte de 3 et à nouveau classées en 280D pour nettoyer davantage l'ensemble de données. Enfin, les images de particules sélectionnées ont été ré-extraites avec une boîte de 1.3 (XNUMX Å / px) et soumises à un raffinement local en utilisant un masque souple généreusement agrandi pour RNAP-δ-HelD monomère ou dimère. Le raffinement local des particules dimères en utilisant le masque monomère a été réalisé comme témoin pour tracer les différences de RNAP-δ-HelD dans les structures monomères et dimères authentiques. Après la correction CTF par particule, un raffinement non uniforme a été appliqué pour générer les reconstructions finales.

Analyse EM des taches négatives

Le complexe RNAP-δ-HelD a été préparé comme pour l'analyse cryoEM, dilué à 25 ug / ml dans le tampon H et supplémenté avec 0.15% n-octylglucoside ou tampon juste avant la préparation de la grille. 4 pi des échantillons ont été ajoutés à des grilles Formvar / carbone déchargées luminescentes (S162, Plano GmbH), laissés à reposer pendant 40 s et tamponnés manuellement avec du papier Whatman n ° 1, suivi de l'addition de 4 pi de 1% (p / v) solution de coloration d'acétate d'uranyle. Après 40 s d'incubation, les grilles ont été manuellement épongées et séchées à température ambiante pendant une nuit. Les échantillons ont été imagés sur un FEI Talos L120C TEM, fonctionnant à 120 kV, équipé d'une caméra FEI CETA 16 M CCD à un grossissement nominal de 57,000 2.53x. La taille de pixel calibrée était de 50 Â / px. Les images ont été acquises manuellement en mode faible dose à l'aide du logiciel TEM Imaging & Analysis (TIA), fourni par le fabricant, accumulant une dose d'électrons totale de XNUMX e-/UNE2. L'analyse des images a été réalisée avec cryoSPARC. Après l'estimation du CTF, des images de particules sélectionnées manuellement ont été utilisées comme référence pour la sélection de particules basée sur un modèle. Les images de particules ont été extraites avec une taille de boîte de 160 px et rééchantillonnées à 80 px. Un masque de 220 Å de diamètre a été appliqué lors de la classification 2D.

Construction de modèles et raffinement

La carte cryoEM finale pour le complexe dimère RNAP-δ-HelD a été utilisée pour la construction initiale du modèle. Coordonnées de M. smegmatis Sous-unités RNAP α, β et β ′ (PDB ID 5VI8)68 ont été ancrés dans la carte cryoEM à l'aide de Coot69. La modélisation de δ était basée sur la structure RMN de Subtilis δ (ID PDB 2M4K)70. La modélisation de ε a été soutenue par la structure de YkzG de Geobacillus stearothermophilus (ID PDB 4NJC)26. La construction du modèle de HelD a été soutenue par la structure de l'hélicase UvrD de E. coli (ID PDB 3LFU)71 ainsi que le domaine C-terminal d'une ADN hélicase putative de Lactobacillus plantarun (ID PDB 3DMN). Les sous-unités ont été reconstruites manuellement dans la carte cryoEM. Le modèle a été complété et ajusté manuellement résidu par résidu, soutenu par le raffinement de l'espace réel dans Coot. Le modèle construit manuellement a été affiné par rapport à la carte cryoEM en utilisant le protocole de raffinement de l'espace réel dans PHENIX72. La construction du modèle du complexe monomère a été faite de la même manière mais en commençant par un modèle de la moitié du complexe dimère. Les structures ont été évaluées avec Molprobity73. Les figures de structure ont été préparées en utilisant PyMOL (version 1.8 Schrödinger, LLC).

Comparaisons de structures

Les structures ont été comparées par superposition globale de structures complexes ou par superposition de sous-unités sélectionnées dans des complexes à l'aide de l'algorithme «Secondary structure matching» implémenté dans Coot ou de l'algorithme «align» implémenté dans PyMOL.

Chromatographie d'exclusion de taille / diffusion de la lumière multi-angle

L'analyse SEC / MALS a été réalisée sur un système HPLC (Agilent) couplé à des détecteurs à diffusion de lumière multi-angle mini DAWN TREOS et à des détecteurs d'indice de réfraction RefractoMax 520 (Wyatt Technology). Le complexe RNAP-δ-HelD a été assemblé comme pour le cryoEM. 60 μl de l'échantillon à 1–1.3 mg / ml ont été chromatographiés sur une colonne Superose 6 Augmentation 10/300 (GE Healthcare) dans le tampon H ou le tampon H plus 0.15% (p / v) n-octylglucoside, supplémenté avec 0.02% (p / v) de NaN3, à 18 ° C avec un débit de 0.6 ml / min. Les données ont été analysées avec le logiciel ASTRA 6.1 (Wyatt Technology) en utilisant de l'albumine de sérum bovin monomère (Sigma-Aldrich) comme référence.

Tests d'interaction

Interactions HelD avec δ ou δNTD ont été analysés par SEC analytique. 21 µM HelD et 42 µM δ ou δNTD ont été mélangés dans 20 mM de HEPES-NaOH, 50 mM de NaCl, 1 mM de DTT, pH 7.5 et incubés pendant 10 min à température ambiante. 50 ul des échantillons ont été chargés sur une colonne Superdex 200 Augmentation PC 3.2 (GE Healthcare) et chromatographiés à 4 ° C avec un débit de 40 ul / min. Les fractions ont été analysées par SDS-PAGE à 12.5%.

Essais de déplacement d'acide nucléique

Montants équimolaires de 5 ′ - [32NtDNA marqué au P] et ADNt non marqué capables de former une bulle artificielle, ou en plus un ARN 9-mère avec complémentarité avec l'ADNt dans la bulle (tableau supplémentaire 1), ont été mélangés dans le tampon G et recuits par chauffage à 95 ° C pendant 5 min et refroidissement subséquent à 25 ° C à 1 ° C / min. Le duplex d'ADN marqué ou l'échafaudage ADN / ARN et RNAPΔδΔHelD (Concentrations finales de 10 nM et 1 uM, respectivement) ont été incubés dans du tampon G pendant 10 min à 4 ° C, suivi d'une incubation supplémentaire de 10 min à 32 ° C. Ensuite, (i) tampon, (ii) HelD (concentration finale 1 uM); (iii) δ (concentration finale 1 µM), (iv) combinaisons de HelD (concentration finale 1 µM) et δ (concentration finale titrée; Fig. 3g) ou (v) HelD et δNTD (Concentration finale de 1 uM chacun) ont été ajoutés, et les échantillons ont encore été incubés pendant 10 minutes à 32 ° C. Les échantillons ont été chargés sur un gel PAGE natif à 4% et soumis à une électrophorèse dans un tampon TBE 0.5X. Les bandes radiomarquées ont été visualisées à l'aide d'un phospohorimager Storm et quantifiées à l'aide du logiciel ImageQuant (GE Healthcare).

Tests de libération HelD

Des quantités équimolaires de HelD et de RNAP en phase stationnaire ont été mélangées dans le tampon I (20 mM TRIS-HCl, 300 mM NaCl, 2 mM DTT, 5% (v / v) glycerol, pH 8.0), incubées pendant 10 min sur de la glace puis pendant 10 min à 32 ° C. L'échantillon a été chromatographié sur une colonne HiLoad Superdex 200 Augmentation 10/300 (GE Healthcare) dans le tampon I. Les fractions ont été analysées par SDS-PAGE à 12.5%, les fractions contenant le complexe RNAP-HelD ont été collectées et concentrées à ~ 3 mg / ml (6.7 µM). 80 ul de ce complexe ont été mélangés avec du tampon I, 5 mM Mg2+-ATPγS / AMPPNP / ATP / ADP / AMP, 6.7 µM σA ou σA plus Mg2+-ATPyS dans le tampon I. 90 ul des échantillons ont été chargés sur une colonne Superdex 200 Augmentation PC 3.2 (GE Healthcare) et chromatographiés à 4 ° C avec un débit de 40 ul / min. Les fractions ont été analysées par SDS-PAGE à 12.5%.

Source: https://www.nature.com/articles/s41467-020-20159-3

Biochimie

Structures du complexe GPR97 – Go du récepteur d'adhésion lié aux glucocorticoïdes

Réédité par Platon

En cliquant sur ce bouton,

on

Aucune méthode statistique n'a été utilisée pour prédéterminer la taille de l'échantillon. Les expériences n'ont pas été randomisées et les chercheurs n'ont pas été aveuglés à l'attribution pendant les expériences et l'évaluation des résultats.

Lignées cellulaires

Les cellules HEK293 ont été obtenues auprès du Centre de ressources cellulaires de l'Institut des sciences biologiques de Shanghai (Académie chinoise des sciences). Spodoptera frugiperda Les cellules (Sf9) ont été achetées auprès d'Expression Systems (cat. 94-001S). Les cellules Y-1 ont été initialement obtenues auprès de l'American Type Culture Collection (ATCC). Les cellules ont été cultivées en culture monocouche dans RPMI 1640 avec 10% de FBS (Gibco) à 37 ° C dans une atmosphère humidifiée constituée de 5% de CO2 et 95% d'air.

Constructions de l'hétérotrimère GPR97 et miniGo

Pour la production de protéines dans les cellules d'insectes, le GPR97 humain (résidus 21 à 549) avec la mutation du motif d'autoprotéolyse (H248 / A et T250 / A) a été sous-cloné dans le vecteur pFastBac1. Le peptide signal natif a été remplacé par le peptide signal d'hémagglutinine (HA) pour améliorer l'expression du récepteur, suivi par un marqueur drapeau DYKDDDK (peptide de Chine) pour faciliter la purification complexe. Un Gα humain conçuo1 avec Gαo1 Suppression du domaine H, nommé miniGαo1 a été cloné dans pFastBac1 selon la littérature publiée29. La Gßl humaine avec l'étiquette hexa-histidine C-terminale et la Gy1 humaine ont été sous-clonées dans le vecteur pFastBacDual. scFv2 a été cloné dans pfastBacl avec le marqueur hexa-histidine C-terminal et le peptide signal GP16 N-terminal. Pour examiner les activités de GPR1, le GPR67-FL-WT (GPR97 pleine longueur de type sauvage), GPR97-FL-AA (mutation du site GPS GPR97, H97 / A et T97 / A), GPR248β (GPR250 avec le NTF retiré , résidus 97-97) et GPR250-β-T (GPR549β avec la séquence de Stachel attachée N-terminale enlevée, résidus 97-97) ont été sous-clones dans le plasmide pcDNA265. Les mutations GPR549 E3.1A, R97A, F298A, F299A, H345A, L353A, Y362A, V363A, F364A, Y370A, W371A, W406A, A421G, I490A, L493A et N494A ont été générées à l'aide du kit de mutagenèse Quikchange. Les sondes BRET de protéine G ont été construites selon les publications précédentes42,43. Sous-unités de la protéine G humaine (Gαq, Gβ1 et Gy2) ont été sous-clonés dans les vecteurs d'expression pcDNA3.1. Le Gαq-RlucII sous-unité a été générée en amplifiant et en insérant la séquence codante de RlucII dans Gαq entre les résidus L97 et K98. Le Gqo sonde, dans laquelle les six acides aminés du C-terminal de Gαq-RlucII ont été remplacés par ceux de Gαo1, a été construit par amplification par PCR en utilisant des oligonucléotides synthétisés codant pour des séquences C-terminales permutées. Le plasmide GFP10 – Gγ2 a été généré en fusionnant la séquence codante GFP10 dans le cadre à l'extrémité N terminale à Gγ2. Toutes les constructions et mutations ont été vérifiées par séquençage d'ADN.

Expression protéique

Des baculovirus recombinants à titre élevé ont été générés en utilisant le système d'expression Bac-to-Bac Baculovirus. En bref, 2 μg de bacmide recombinant et 2 μl de réactif de transfection X-tremGENE HP (Roche) dans 100 μl de milieu Opti-MEM (Gibco) ont été mélangés et incubés pendant 20 min à température ambiante. La solution de transfection a été ajoutée à 2.5 ml de cellules Sf9 avec une densité de 1 x 106 par ml dans une plaque à 24 puits. Les cellules infectées ont été cultivées dans un agitateur à 27 ° C pendant 4 jours. Le virus P0 a été collecté puis amplifié pour générer le virus P1. Les titres viraux ont été déterminés par analyse cytométrique en flux de cellules colorées avec l'anticorps gp64-PE (dilution 1: 200; 12-6991-82, Thermo Fisher). Ensuite, les cellules Sf9 ont été infectées par des virus codant GPR97-FL-AA, miniGαo, Gβγ, et avec ou sans scFv16, respectivement, à multiplicité d'infection égale. Les cellules infectées ont été cultivées à 27 ° C, 110 tr / min pendant 48 h avant la collecte. Les cellules ont finalement été collectées par centrifugation et les culots cellulaires ont été stockés à -80 ° C.

GPR97 – Go formation et purification complexes

Granulés cellulaires transfectés avec le virus englobant le GPR97-FL-AA, le trimère miniGo et le scFv16 (n'existaient que dans les culots cellulaires pour purifier le cortisol – GPR97-FL-AA – Go–ScFv16) ont été remis en suspension dans 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% glycérol, 10 mM MgCl2 et 5 mM de CaCl2 supplémenté avec Protease Inhibitor Cocktail (B14001, Bimake) et 100 μM de TCEP (Thermo Fisher Scientific). Le complexe a été formé pendant 2 h à température ambiante en ajoutant 10 μM de BCM (HY-B1540, MedChemExpress) ou de cortisol (HY-N0583, MedChemExpress), 25 mU / ml d'apyrase (Sigma), puis solubilisé à 0.5% (p / v) lauryl maltose néopentylglycol (LMNG; Anatrace) et 0.1% (p / v) de sel TRIS d'hémisuccinate de cholestérol (CHS; Anatrace) pendant 2 h à 4 ° C. Le surnageant a été recueilli par centrifugation à 30,000 40 tr / min pendant 2 min, et le complexe solubilisé a été incubé avec une résine de nickel pendant 4 h à 20 ° C. La résine a été collectée et lavée avec 20 volumes de colonne de HEPES 7.4 mM, pH 100, NaCl 10 mM, glycérol 2%, MgCl XNUMX mM.2, 25 mM d'imidazole, 0.01% (p / v) LMNG, 0.01% de GDN (Anatrace), 0.004% (p / v) de CHS, 10 μM de BCM (ou cortisol) et 100 μM de TCEP. Le complexe a été élue avec 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% de glycérol, 2 mM MgCl2, 200 mM d'imidazole, 0.01% (p / v) LMNG, 0.01% de GDN, 0.004% (p / v) CHS, 10 μM BCM (ou cortisol) et 100 μM TCEP. L'élution de la résine de nickel a été appliquée à la résine anti-drapeau M1 (Sigma) pendant 2 h et lavée avec 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% de glycérol, 2 mM MgCl2, 5 mM CaCl2, 0.01% (w / v) LMNG, 0.01% GDN, 0.004% (w / v) CHS, 10 μM BCM (ou cortisol) et 100 μM TCEP. Le GPR97 – Go complexe a été élue dans un tampon contenant 20 mM HEPES, pH 7.4, 100 mM NaCl, 10% de glycérol, 2 mM MgCl2, 0.01% (w / v) LMNG, 0.01% GDN, 0.004% (w / v) CHS, 10 μM BCM (ou cortisol), 100 μM TCEP, 5 mM EGTA et 0.2 mg / ml de peptide Flag. Le complexe a été concentré puis injecté sur une colonne Superdex 200 augmentation 10/300 GL équilibrée dans le tampon contenant 20 mM HEPES, pH 7.4, 100 mM NaCl, 2 mM MgCl2, 0.00075% (w / v) LMNG, 0.00025% GDN, 0.0002% (w / v) CHS, 10 μM BCM (ou cortisol) et 100 μM TCEP. Les fractions complexes ont été collectées et concentrées individuellement pour des expériences EM.

Préparation de la grille Cryo-EM et collecte de données

Pour la préparation des grilles cryo-EM, 3 μl de GPR97 – G purifié lié au BCM et au cortisolo Le complexe à environ 20 mg / ml a été appliqué sur une grille de carbone trouée à décharge luminescente (Quantifoil R1.2 / 1.3). Les grilles ont été congelées en plongée dans de l'éthane liquide refroidi par de l'azote liquide en utilisant Vitrobot Mark IV (Thermo Fisher Scientific). L'imagerie Cryo-EM a été réalisée sur un Titan Krios à une tension d'accélération de 300 kV au Centre de Microscopie Cryo-Electronique de l'Université du Zhejiang. Les micrographies ont été enregistrées en utilisant un détecteur d'électrons directs Gatan K2 Summit en mode de comptage avec un grossissement nominal de × 29,000 1.014, ce qui correspond à une taille de pixel de 7.8 Â. Les films ont été obtenus en utilisant serialEM à un débit de dose d'environ XNUMX électrons par Å2 par seconde avec une défocalisation allant de −0.5 à −2.5 μm. Le temps d'exposition total était de 8 s et les images intermédiaires ont été enregistrées à intervalles de 0.2 s, ce qui a entraîné une dose cumulée de 62 électrons par Å2 et un total de 40 images par micrographie. Au total, 2,707 5,871 et 97 XNUMX films ont été collectés pour le GPRXNUMX – G lié au BCM et au cortisol.o complexe, respectivement.

Traitement des données Cryo-EM

Piles d'images fractionnées par dose pour le BCM – GPR97 – Go complexe ont été soumis à une correction de mouvement induite par le faisceau à l'aide de MotionCor2.144. Les paramètres de la fonction de transfert de contraste (FCT) pour chaque micrographie non pondérée en fonction de la dose ont été déterminés par Gctf45. Sélection de particules, classifications 2D et 3D du BCM – GPR97 – Go complexe ont été réalisés sur un ensemble de données regroupées avec une taille de pixel de 2.028 Å en utilisant RELION-3.0-beta246.

Pour le BCM – GPR97 – Go une sélection de particules complexe et semi-automatisée a donné 2,026,926 2 911,519 projections de particules. Les projections ont été soumises à une classification 5D sans référence pour rejeter des particules dans des classes mal définies, produisant XNUMX XNUMX projections de particules pour un traitement ultérieur. La carte du XNUMX-HT1BComplexe R – miniGo (EMDB-4358)47 Le filtre passe-bas à 40 Å a été utilisé comme modèle de référence pour la classification 3D basée sur le maximum de vraisemblance, ce qui a donné un sous-ensemble bien défini avec 307,700 3 projections. D'autres classifications 166,116D concentrant l'alignement sur le complexe ont produit deux bons sous-ensembles qui représentaient 3 3.1 particules, qui ont ensuite été soumises à un raffinement 0.143D, un raffinement CTF et un polissage bayésien. Le raffinement final a généré une carte avec une résolution globale indiquée de XNUMX Å à une corrélation de la coquille de Fourier de XNUMX.

Pour le cortisol – GPR97 – Go la sélection complexe de particules a donné 4,323,518 2 2,201,933 projections de particules pour une classification 3D sans référence. Les classes bien définies avec 335,552 3 75,814 projections de particules ont été sélectionnées pour deux autres cycles de classification 3D en utilisant la carte du complexe lié au BCM comme référence. Un bon sous-ensemble qui représentait 2.9 XNUMX projections de particules a été sélectionné pour deux autres séries de classifications XNUMXD qui ont concentré l'alignement sur le complexe et ont produit un sous-ensemble de haute qualité avec XNUMX XNUMX projections de particules. Les projections de particules finales ont ensuite été soumises à un raffinement XNUMXD, un raffinement CTF et un polissage bayésien, ce qui génère une carte avec une résolution globale de XNUMX Å. La résolution locale pour les deux cartes de densité a été déterminée à l'aide du package Bsoft avec des demi-cartes comme cartes d'entrée48.

Construction de modèles et raffinement

Pour la structure du BCM – GPR97 – Go complexe, le modèle initial de GPR97 a été généré à l'aide du module 'map to model' dans PHENIX44. La coordonnée du 5-HT1BR – Go complexe (PDB ID: 6G79) a été utilisé pour générer les modèles initiaux pour Go (réf. 44). Les modèles ont été ancrés dans la carte de densité EM à l'aide de UCSF Chimera49, suivi d'une reconstruction manuelle itérative dans COOT50 selon les densités des chaînes latérales. Les coordonnées BCM et lipidiques et les contraintes géométriques ont été générées à l'aide de phenix.elbow. BCM a été construit sur le modèle en utilisant le module «LigandFit» de PHENIX. Le placement du BCM montre un coefficient de corrélation de 0.81, indiquant un bon ajustement du ligand à la densité. Le modèle a été soumis à un raffinement dans l'espace réel à l'aide de Rosetta51 et PHENIX44.

Pour la structure du cortisol – GPR97 – Go complexe, les coordonnées de GPR97 et Go du complexe lié au BCM et scFv16 du NTSR1 – G humaini1 complexe (PDB ID: 6OS9) ont été utilisés comme modèle initial. Les modèles ont été ancrés dans la carte de densité, puis reconstruits manuellement dans COOT. Le cortisol agoniste a été construit sur le modèle en utilisant le module «LigandFit» comme décrit, montrant un bon ajustement de densité avec un coefficient de corrélation de 0.80. Le modèle a été encore affiné avec Rosetta51 et PHENIX44. Les statistiques de raffinement finales pour les deux structures ont été validées à l'aide du module `` validation complète (cryo-EM) '' dans PHENIX44. La qualité de l'ajustement du modèle à la carte a été réalisée pour les deux structures à l'aide d'un FSC global modèle contre carte (Extended Data Fig. 2). Les statistiques de raffinement sont fournies dans le tableau de données étendu 1. Les figures des structures ont été générées à l'aide de UCSF Chimera, UCSF ChimeraX52 et PyMOL53.

Simulation de la dynamique moléculaire des complexes BCM – GPR97 et cortisol – GPR97

Sur la base des poses de liaison favorables du BCM et du cortisol avec le récepteur GPR97, qui a été calculé par le programme LigandFit de PHENIX, les complexes GPR97 – agoniste étaient le substrat des deux GPR97 – agoniste – mGo complexes pour la simulation de dynamique moléculaire. Les orientations des récepteurs ont été calculées par la base de données Orientations of Proteins in Membranes (OPM). Suite à cela, l'ensemble des systèmes ont été préparés par le CHARM-GUI et intégrés dans une bicouche composée de 200 1-palmitoyl-2-oléoyl-sn-glycéro-3-phosphocholine (POPC) par des méthodes de remplacement. Les systèmes de membranes ont ensuite été solvatés dans une boîte à eau TIP3P périodique additionnée de 0.15 M de NaCl. Le CHARMM36m Force Filed a été utilisé pour modéliser des molécules de protéines, CHARMM36 Force Filed pour les lipides et le sel avec CHARMM General Force Field (CGenFF) pour les molécules agonistes BCM et cortisol.

Ensuite, le système a été soumis à une minimisation pendant 10,000 310.13 étapes en utilisant l'algorithme de gradient conjugué, puis chauffé et équilibré à 1 K et 200 atm pour 10.0 ps avec XNUMX kcal mol-1 Å-2 contraintes harmoniques dans le logiciel NAMD 2.13. Viennent ensuite cinq cycles d'équilibrage pour 2 ns chacun à 310.13 K et 1 atm, pour lesquels les contraintes harmoniques étaient de 5.0, 2.5, 1.0, 0.5 et 0.1 kcal mol-1 Å-2 en séquence.

Des simulations de production ont été effectuées à 310.13 K et 1 atm dans l'ensemble NPT en utilisant le thermostat Langevin et la méthode Nose – Hoover pendant 200 ns. Les interactions électrostatiques ont été calculées à l'aide de la méthode du maillage de particules Ewald (PME) avec un seuil de 12 Â. Tout au long des étapes finales d'équilibrage et de production, 5.0 kcal mol-1 Å-2 des contraintes harmoniques ont été placées sur les résidus de GPR97 qui étaient à moins de 5 Å de Go dans le BCM (ou cortisol) –GPR97 – Go complexe pour garantir que le récepteur reste à l'état actif en l'absence de la protéine G. Les trajectoires ont été visualisées et analysées à l'aide de Visual Molecular Dynamics (VMD, version 1.9.3)

Détection ELISA de l'AMPc dans les cellules Y-1

Les cellules Y-1 ont été transfectées avec Gpr97 siRNA (si-97, GUGCAGGGAAUGUCUUUAA) ou siRNA de contrôle (si-Con) pendant 48 h. Après 12 h de famine dans un milieu sans sérum, les cellules ont été encore stimulées avec de la cortisone (8 nM), de la forskoline (5 uM) (Sigma-Aldrich) ou un véhicule témoin pendant 10 min. Ensuite, les cellules ont été lavées trois fois avec du PBS pré-refroidi et remises en suspension dans HCl 0.1 N pré-refroidi contenant 500 uM d'IBMX à un rapport de 1: 5 (p / v). Les échantillons ont été neutralisés avec NaOH 1 N à un rapport 1:10 (v / v) après 10 minutes. Les surnageants ont été collectés après centrifugation des échantillons à 600g pendant 10 min. Les surnageants ont ensuite été préparés pour la détermination de l'AMPc en utilisant le kit d'analyse des paramètres de l'AMPc (R&D Systems) selon les instructions du fabricant. le Gpr97 le niveau d'expression dans diverses conditions a été en outre confirmé en utilisant une PCR quantitative en temps réel.

Mesures de corticostérone

Des cellules Y-1 de la lignée cellulaire d'adrénocorticotome de souris ont été transfectées avec Gpr97 siRNA (si-97) ou siRNA de contrôle (si-Con) pendant 48 h. Ensuite, les cellules ont été traitées avec du milieu sans sérum pendant 12 h. Après cela, de la cortisone (16 nM) ou de l'ACTH (0.5 uM) ont été ajoutés aux cellules pendant 30 min. Les surnageants du milieu de culture cellulaire ont été collectés pour des mesures de corticostérone par ELISA selon les instructions du fabricant.

PCR quantitative en temps réel

L'ARN total des cellules a été extrait en utilisant une méthode d'isolation ARN TRIzol standard. Les expériences de transcription inverse et de PCR ont été réalisées avec le kit Revertra Ace qPCR RT (TOYOBO FSQ-101) en utilisant 1.0 μg de chaque échantillon, selon les protocoles du fabricant. La PCR quantitative en temps réel a été réalisée dans l'appareil Light Cycler (Bio-Rad) en utilisant le FastStart Universal SYBR Green Master (Roche). Le niveau d'ARNm a été normalisé en GAPDH dans le même échantillon et ensuite comparé au témoin. Les amorces sens et inverse pour GPR97 utilisées dans les expériences étaient CAGTTTGGGACTGAGGGACC et GCCCACACTTGGTGAAACAC. Le niveau d'ARNm de GAPDH a été utilisé comme contrôle interne. Les amorces sens et inverse pour GAPDH étaient GCCTTCCGTGTTCCTACC et GCCTGCTTCACCACCTTC.

test d'inhibition de l'AMPc

Pour mesurer les effets inhibiteurs sur l'accumulation d'AMPc induite par la forskoline de différentes constructions ou mutants GPR97 en réponse à différents ligands ou à une activité constitutive, le test GloSensor cAMP (Promega) a été réalisé selon les publications précédentes12,13. Les cellules HEK293 ont été co-transfectées de manière transitoire avec le GloSensor et diverses versions de plasmides GPR97 ou véhicule (pcDNA3.1) en utilisant PEI dans des plaques à six puits. Après incubation à 37 ° C pendant 24 h, les cellules transfectées ont été ensemencées dans des plaques à 96 puits avec du milieu DMEM sans sérum (Gibco) et incubées pendant 24 h supplémentaires à 37 ° C dans un 5% de CO2 atmosphère. Différents ligands ont été dissous dans du DMSO (Sigma) à une concentration stock de 10 mM et suivis d'une dilution en série en utilisant une solution de PBS immédiatement avant la stimulation du ligand. Les cellules transfectées ont été pré-incubées avec 50 ul de milieu DMEM sans sérum contenant le réactif GloSensor cAMP (Promega). Après incubation à 37 ° C pendant 2 h, des concentrations variables de ligands ont été ajoutées dans chaque puits et suivies de l'addition de forskoline à 1 uM. L'intensité de luminescence a été examinée sur un détecteur de microplaques multi-marqueurs EnVision (Perkin Elmer).

Le Gqo test BRET d'activation des protéines

Selon des publications antérieures, l'activité GPR97 induite par le dipropionate BCM pourrait être mesurée par G chimèreqo dosages de protéines25. Le Gqo Les sondes BRET ont été générées en remplaçant les six acides aminés du C-terminal de Gq-RlucII avec ceux de GoA1, créant un G chimériqueqo-Sous-unité RlucII47. GFP10 était connecté à Gγ. Le Gqo le test d'activation des protéines BRET a été réalisé comme décrit précédemment54. En bref, les cellules HEK293 ont été co-transfectées de manière transitoire avec le contrôle D2R et diverses constructions GPR97, plasmides codant pour le Gqo Sondes BRET, incubées à 37 ° C dans un 5% CO2 atmosphère pendant 48 h. Les cellules ont été lavées deux fois avec du PBS, collectées et remises en suspension dans un tampon contenant 25 mM HEPES, pH 7.4, 140 mM NaCl, 2.7 mM KCl, 1 mM CaCl2, 12 mM NaHCO3, 5.6 mM d-glucose, 0.5 mM de MgCl2 et 0.37 mM NaH2PO4. Cellules distribuées dans une microplaque à 96 puits à une densité de 5 à 8 × 104 les cellules par puits ont été stimulées avec différentes concentrations de ligands. BRET2 entre RLucII et GFP10 a été mesurée après l'ajout du substrat coelenterazine 400a (5 µM, Interchim) (Cayman) à l'aide d'un lecteur multimode Mithras LB940 (Berthold Technologies). Le BRET2 le signal a été calculé comme le rapport d'émission de GFP10 (510 nm) à RLucII (400 nm).

Mesure de l'expression de la surface des cellules du récepteur par ELISA

Pour évaluer le niveau d'expression de GPR97 de type sauvage et de ses mutants, des cellules HEK293 ont été transfectées de manière transitoire avec du GPR97 de type sauvage et mutant ou un véhicule (pcDNA3.1) en utilisant PEI regent at dans des plaques à six puits. Après incubation à 37 ° C pendant 18 h, les cellules transfectées ont été plaquées dans des plaques de 24 puits à une densité de 105 cellules par puits et incubées à 37 ° C dans un 5% de CO2 ambiance pendant 18 h. Les cellules ont ensuite été fixées dans du paraformaldéhyde à 4% (p / v) et bloquées avec 5% (p / v) de BSA à température ambiante. Chaque puits a été incubé avec 200 pi d'anticorps primaire anti-FLAG monoclonal (F1804, Sigma-Aldrich) pendant une nuit à 4 ° C et suivi par l'incubation d'un anticorps secondaire de chèvre anti-souris (A-21235, Thermo Fisher) conjugué au peroxyde de raifort pendant 1 h à température ambiante. Après lavage, on a ajouté 200 pi d'une solution de 3,3 ', 5,5'-tétraméthylbenzidine (TMB). Les réactions ont été désactivées en ajoutant un volume égal de solution de HCl 0.25 M et la densité optique à 450 nm a été mesurée en utilisant le compteur de luminescence TECAN (Infinite M200 Pro NanoQuant). Pour la détermination des activités constitutives de différentes constructions ou mutants GPR97, des concentrations variables de plasmides souhaités ont été transfectées de manière transitoire dans des cellules HEK293 et ​​l'absorbance à 450 nm a été mesurée.

Le test FlAsH-BRET

Les cellules HEK293 ont été ensemencées dans des plaques à six puits après transfection avec GPR97-FlAsH avec Nluc inséré dans un site N-terminal spécifique. Avant le test BRET, les cellules HEK293 étaient privées de sérum pendant 1 h. Ensuite, les cellules ont été digérées, centrifugées et remises en suspension dans 500 ul de tampon BRET (25 mM HEPES, 1 mM CaCl2, 140 mM de NaCl, 2.7 mM de KCl, 0.9 mM de MgCl2, 0.37 mM NaH2PO4, 5.5 mM d-glucose et NaHCO 12 mM3). Le FlAsH-EDT2 a été ajouté à une concentration finale de 2.5 uM et incubé à 37 ° C pendant 60 min. Par la suite, les cellules HEK293 ont été lavées avec du tampon BRET et ensuite distribuées dans des plaques à 96 puits à fond transparent à paroi noire, avec environ 100,000 10 cellules par puits. Les cellules ont été traitées avec une concentration finale de BCM et de cortisol à XNUMX-5 - 10-11 puis le coelenterazinc H a été ajouté à une concentration finale de 5 μM, suivi par la vérification immédiate des émissions de luciférase (440–480 nm) et de FlAsH (525–585 nm). Le rapport BRET (émission de protéine fluorescente jaune améliorée / émission Nluc) a été calculé à l'aide d'un spectrofluorimètre Berthold Technologies Tristar 3 LB 941. La procédure a été modifiée par rapport à celles décrites précédemment34,55,56.

analyses statistiques

Un test ANOVA unidirectionnel a été réalisé pour évaluer la signification statistique entre les différentes versions de GPR97 et leur mutant en termes de niveau d'expression, de puissance ou d'efficacité à l'aide de GraphPad Prism. Pour toutes les expériences, l'erreur standard de la moyenne des valeurs calculées sur la base des ensembles de données de trois expériences indépendantes est indiquée dans les légendes des figures respectives.

Résumé du rapport

De plus amples informations sur le design de la recherche sont disponibles dans Résumé de la recherche sur la nature lié à cet article.

Source: https://www.nature.com/articles/s41586-020-03083-w

Continuer la lecture

Biochimie

Une méthodologie 'Build and Retrieve' pour résoudre simultanément les structures cryo-EM des protéines membranaires

Réédité par Platon

En cliquant sur ce bouton,

on

  • 1.

    Vinothkumar, KR & Henderson, R. Cryomicroscopie électronique à particule unique: tendances, problèmes et perspectives d'avenir. Q. Rév. Biophys. 49, 1 – 25 (2016).

    Article  Google Scholar 

  • 2.

    Herzik, MAJr, Wu, M. & Lander, GC Détermination de la structure à haute résolution de complexes de moins de 100 kDa en utilisant la cryo-EM conventionnelle. Nat. Commun. 10, 1032 (2019).

    Article  Google Scholar 

  • 3.

    Ho, CM et coll. Structure translocon du parasite du paludisme et mécanisme d'exportation des effecteurs. Nature 561, 70 – 75 (2018).

    CAS  Article  Google Scholar 

  • 4.

    Morgan, CE et coll. Structure de microscopie cryoélectronique du Acinetobacter baumannii Ribosome 70S et implications pour le développement de nouveaux antibiotiques. MBIO 11, e03117 à e03119 (2020).

    CAS  Article  Google Scholar 

  • 5.

    Adams, PD et coll. PHENIX: création d'un nouveau logiciel pour la détermination automatisée de la structure cristallographique. Acta Crystallogr. D Biol. Crystallogr. 58, 1948 – 1954 (2002).

    Article  Google Scholar 

  • 6.

    Emsley, P. & Cowtan, K. Coot: outils de création de modèles pour les graphiques moléculaires. Acta Crystallogr. D Biol. Crystallogr. 60, 2126 – 2132 (2004).

    Article  Google Scholar 

  • 7.

    Daligault, HE et coll. Assemblées du génome entier de 56 Burkholderia espèces. Annonce du génome. 2, e01106 à e01114 (2014).

    PubMed  Central PubMed  Google Scholar 

  • 8.

    Doughty, DM et coll. Le transporteur de la famille RND, HpnN, est nécessaire pour la localisation des hopanoïdes sur la membrane externe de Rhodopseudomonas palustris TIE-1. Proc. Natl Acad. Sci. Etats-Unis 108, E1045 à E1051 (2011).

    CAS  Article  Google Scholar 

  • 9.

    Sousa, FL et coll. La superfamille des réductases d'oxygène hème-cuivre: types et considérations évolutives. Biochim. Biophys. Acta 1817, 629 – 637 (2012).

    CAS  Article  Google Scholar 

  • 10.

    Abramson, J. et coll. La structure de l'ubiquinol oxydase de Escherichia coli et son site de liaison à l'ubiquinone. Nat. Struct. Biol. 7, 910 – 917 (2000).

    CAS  Article  Google Scholar 

  • 11.

    Yap, LL et coll. Les sites de liaison à la quinone de l'ubiquinol oxydase du cytochrome bo3 de Escherichia coli. Biochim. Biophys. Acta 1797, 1924 – 1932 (2010).

    CAS  Article  Google Scholar 

  • 12.

    Choi, SK et coll. Emplacement du site de liaison au substrat du cytochrome bo3 ubiquinol oxydase de Escherichia coli. Confiture. Chem. Soc. 139, 8346 – 8354 (2017).

    CAS  Article  Google Scholar 

  • 13.

    Kumar, N. et coll. Structures cristallines du Burkholderia multivorans transporteur hopanoïde HpnN. Proc. Natl Acad. Sci. Etats-Unis 114, 6557 – 6562 (2017).

    CAS  Article  Google Scholar 

  • 14.

    Centres pour le Contrôle et la Prévention des catastrophes. Agents / maladies du bioterrorisme (US Department of Health and Human Services, 2018); https://emergency.cdc.gov/agent/agentlist-category.asp

  • 15.

    Wagar, E. Le bioterrorisme et le rôle du laboratoire de microbiologie clinique. Clin. Microbiol. Tour. 29, 175 – 189 (2016).

    Article  Google Scholar 

  • 16.

    Christopher, GW, Cieslak, TJ, Pavlin, JA & Eitzen, EMJr Guerre biologique. Une perspective historique. JAMA 278, 412 – 417 (1997).

    CAS  Article  Google Scholar 

  • 17.

    Nierman, WC et coll. Flexibilité structurelle dans le Burkholderia mallei génome. Proc. Natl Acad. Sci. Etats-Unis 101, 14246 – 14251 (2004).

    CAS  Article  Google Scholar 

  • 18.

    Schweizer, HP Mécanismes de résistance aux antibiotiques dans Burkholderia pseudomallei: implications pour le traitement de la mélioïdose. Future Microbiol. 7, 1389 – 1399 (2012).

    CAS  Article  Google Scholar 

  • 19.

    Malott, RJ, Steen-Kinnaird, BR, Lee, TD & Speert, DP Identification des gènes de biosynthèse des hopanoïdes impliqués dans la résistance à la polymyxine chez Burkholderia multivorans. Antimicrob. Agents Chemother. 56, 464 – 471 (2012).

    CAS  Article  Google Scholar 

  • 20.

    Malott, RJ et coll. La fosmidomycine diminue les hopanoïdes membranaires et potentialise les effets de la colistine sur Burkholderia multivorans isolats cliniques. Antimicrob. Agents Chemother. 58, 5211 – 5219 (2014).

    Article  Google Scholar 

  • 21.

    Nikaido, H. Bases moléculaires de la perméabilité bactérienne de la membrane externe revisitée. Microbiol. Mol. Biol. Tour. 67, 593 – 656 (2003).

    CAS  Article  Google Scholar 

  • 22.

    Cowan, SW et coll. Les structures cristallines expliquent les propriétés fonctionnelles de deux E. coli porines. Nature 358, 727 – 733 (1992).

    CAS  Article  Google Scholar 

  • 23.

    Yankovskaya, V. et al. Architecture de la succinate déshydrogénase et de la génération d'espèces réactives de l'oxygène. Science 299, 700 – 704 (2003).

    CAS  Article  Google Scholar 

  • 24.

    Baslé, A., Rummel, G., Storici, P., Rosenbusch, JP & Schirmer, T.Structure cristalline de l'osmoporine OmpC de E. coli à 2.0 Â. J. Mol. Biol. 362, 933 – 942 (2006).

    Article  Google Scholar 

  • 25.

    Carpena, X., Melik-Adamyan, W., Loewen, PC & Fita, I. Structure du domaine C-terminal de la catalase-peroxydase KatG de Escherichia coli. Acta Crystallogr. D Biol. Crystallogr. 60, 1824 – 1832 (2004).

    Article  Google Scholar 

  • 26.

    Capitani, G. et coll. Structure cristalline et analyse fonctionnelle de Escherichia coli glutamate décarboxylase. EMBO J. 22, 4027 – 4037 (2003).

    CAS  Article  Google Scholar 

  • 27.

    Chorev, DS et coll. Les assemblages de protéines éjectés directement des membranes natives donnent des complexes pour la spectrométrie de masse. Science 362, 829 – 834 (2018).

    CAS  Article  Google Scholar 

  • 28.

    Ho, CM et coll. Protéomique structurale ascendante: cryoEM de complexes protéiques enrichis du milieu cellulaire. Nat. Les méthodes 17, 79 – 85 (2020).

    CAS  Article  Google Scholar 

  • 29.

    Kastritis, PL et al. Capturer les communautés protéiques par protéomique structurale chez un eucaryote thermophile. Mol. Syst. Biol. 13, 936 (2017).

    Article  Google Scholar 

  • 30.

    Yi, X., Verbeke, EJ, Chang, Y., Dickinson, DJ & Taylor, DW Instantanés de microscopie électronique de particules uniques provenant de cellules individuelles. J. Biol. Chem. 294, 1602 – 1608 (2019).

    CAS  Article  Google Scholar 

  • 31.

    Schmidli, C. et al. Isolement de protéines microfluidiques et préparation d'échantillons pour la cryo-EM haute résolution. Proc. Natl Acad. Sci. Etats-Unis 116, 15007 – 15012 (2019).

    CAS  Article  Google Scholar 

  • 32.

    Long, F. et coll. Les structures cristallines de la pompe d'efflux CusA suggèrent un transport de métal médié par la méthionine. Nature 467, 484 – 488 (2010).

    CAS  Article  Google Scholar 

  • 33.

    Mastronarde, DN Tomographie au microscope électronique automatisée utilisant une prédiction robuste des mouvements des échantillons. J. Struct. Biol. 152, 36 – 51 (2005).

    Article  Google Scholar 

  • 34.

    Zheng, SQ et coll. MotionCor2: correction anisotrope du mouvement induit par le faisceau pour une microscopie cryoélectronique améliorée. Nat. Les méthodes 14, 331 – 332 (2017).

    CAS  Article  Google Scholar 

  • 35.

    Punjani, A., Rubinstein, JL, Fleet, DJ & Brubaker, MA cryoSPARC: algorithmes pour la détermination rapide de la structure cryo-EM non supervisée. Nat. Les méthodes 14, 290 – 296 (2017).

    CAS  Article  Google Scholar 

  • 36.

    Terwilliger, TC, Ludtke, SJ, Read, RJ, Adams, PD & Afonine, PV Amélioration des cartes cryo-EM par modification de la densité. Nat. Les méthodes 17, 923 – 927 (2020).

    CAS  Article  Google Scholar 

  • 37.

    Afonine, PV et al. Raffinement de l'espace réel dans PHENIX pour la cryo-EM et la cristallographie. Acta Crystallogr. D Struct. Biol. 74, 531 – 544 (2018).

    CAS  Article  Google Scholar 

  • 38.

    Chen, VB et coll. MolProbity: validation de la structure de tous les atomes pour la cristallographie macromoléculaire. Acta Crystallogr. D Biol. Crystallogr. 66, 12 – 21 (2010).

    CAS  Article  Google Scholar 

  • 39.

    Marty, MT et coll. Déconvolution bayésienne des spectres de masse et de mobilité ionique: des interactions binaires aux ensembles polydispersés. Anal. Chem. 87, 4370 – 4376 (2015).

    CAS  Article  Google Scholar 

  • 40.

    Shevchenko, A., Wilm, M., Vorm, O. & Mann, M. Séquençage par spectrométrie de masse de protéines à partir de gels de polyacrylamide colorés à l'argent. Anal. Chem. 68, 850 – 858 (1996).

    CAS  Article  Google Scholar 

  • Source: https://www.nature.com/articles/s41592-020-01021-2

    Continuer la lecture

    Biochimie

    Glycoprotéomique

    Réédité par Platon

    En cliquant sur ce bouton,

    on

    La glycoprotéomique arrive à maturité, grâce aux progrès de l'instrumentation, des méthodologies expérimentales et des algorithmes de recherche informatique.

    La glycosylation est l'une des modifications post-traductionnelles les plus courantes, et les glycoprotéines jouent un rôle crucial dans des processus biologiques importants tels que la signalisation cellulaire, l'interaction hôte-pathogène, la réponse immunitaire et la maladie, y compris le cancer et même la pandémie COVID-19 en cours (Science 369, 330–333, 2020). La glycoprotéomique vise à déterminer les positions et les identités du répertoire complet des glycanes et des protéines glycosylées dans une cellule ou un tissu donné.

    Les glycanes sont partout. Les approches glycoprotéomiques à haut débit offrent des informations. Crédits: Katherine Vicari, Springer Nature

    Les approches basées sur la spectrométrie de masse (MS) permettent une analyse globale à grande échelle; cependant, la diversité structurelle des glycanes et la nature hétérogène des sites de glycosylation rendent une analyse complète particulièrement difficile. Les glycanes empêchent la fragmentation complète du squelette protéique, et ils ont été traditionnellement supprimés pour plus de simplicité au prix de la perte d'informations sur les glycanes. Les spectres MS ont tendance à être compliqués en raison de la présence d'isomères, nécessitant souvent une interprétation manuelle. En outre, la recherche de bases de données pour les correspondances spectrales peut rapidement devenir un problème combinatoire et nécessite des solutions bioinformatiques innovantes.

    Développements récents dans l'instrumentation MS, stratégies de fragmentation (J. Proteome Res. 19, 3286–3301, 2020) et les flux de travail à haut débit ont rendu possible l'analyse des glycoprotéines intactes. Plusieurs stratégies d'enrichissement spécifiques ont rendu détectables même les glycanes et les glycopeptides de faible abondance (Mol. Cellule. Protéomique https://doi.org/10.1074/mcp.R120.002277, 2020). Une variété de flux de travail expérimentaux adaptés soit aux glycanes N-liés, qui se trouvent sur des sites consensus sur les protéines, soit aux glycanes O-liés, qui n'ont pas de séquence consensus reconnaissable, ont été développés (Nature 549, 538–542, 2017; Nat. Commun. 11, 5268, 2020; Nat. Les méthodes 16, 902–910, 2019). Les nouveaux progiciels basés sur des stratégies d'indexation fragment-ion offrent des augmentations substantielles de vitesse pour les affectations de glycopeptides et de sites (Nat. Les méthodes 17, 1125–1132, 2020; Nat. Les méthodes 17, 1133–1138, 2020).

    Alors que d'autres domaines de la -omique occupent la part du lion ces dernières années, il est maintenant temps que la glycoprotéomique brille. Une compréhension approfondie de la glycosylation à différents niveaux de granularité est destinée à servir à la fois la recherche fondamentale et translationnelle.

    Information sur l'auteur

    Affiliations

    Auteurs

    auteur correspondant

    Correspondance à Arunima Singh.

    Droits et permissions

    Réimpressions et autorisations

    A propos de cet article

    Vérifiez la devise et l'authenticité via CrossMark

    Cite cet article

    Singh, A. Glycoproteomics. Méthodes Nat 18, 28 (2021). https://doi.org/10.1038/s41592-020-01028-9

    Télécharger la citation

    Source: https://www.nature.com/articles/s41592-020-01028-9

    Continuer la lecture
    HeartlandIl y a 5 jours

    Bonjour, je suis nouveau sur le CBD et je viens de recevoir cet e-liquide et un stylo. J'ai regardé le jus de vape après, et il ne semble pas exister. Est-ce que quelqu'un d'autre a utilisé cette marque?

    MétalIl y a 4 jours

    ArcelorMittal augmente les prix du CRC et du HDG en Europe

    ActualitésIl y a 4 jours

    Traitement automatisé de la ferraille aérospatiale pour les éléments précieux

    MétalIl y a 4 jours

    Le PMI manufacturier américain s'élève à 60.8% en février

    HeartlandJour il ya 1

    Pourquoi CBD est un excellent partenaire pour toute routine de bien-être

    HeartlandIl y a 4 jours

    Meilleur magasin CBD en Europe?

    HeartlandIl y a 5 jours

    ...

    HeartlandIl y a 4 jours

    Les 5 principales raisons pour lesquelles les gens utilisent CBD Teintures

    HeartlandIl y a 4 jours

    ...

    HeartlandIl y a 3 jours

    CBD et ménopause

    HeartlandIl y a 5 jours

    ...

    HeartlandIl y a 4 jours

    Isolats de CBD recommandés?

    HeartlandIl y a 4 jours

    ...

    HeartlandIl y a 4 jours

    Les cannabinoïdes dans les crises audiogéniques: des réseaux neuronaux aux perspectives futures pour le traitement de l'épilepsie

    MatériauxIl y a 2 jours

    Effets des rayonnements induits sur les micro-rayures des biocomposites de polyéthylène de poids moléculaire ultra élevé

    HeartlandJour il ya 1

    Retirer le limonène de l'huile

    HeartlandIl y a 4 jours

    Fleur de CBD

    HeartlandIl y a 4 jours

    CBD Marché des bonbons gélifiés 2021 Acteurs clés - Reliva CBD Bien-être, effrayants du dimanche, vert…

    HeartlandIl y a 4 jours

    Cannabinoïdes, traitement des récompenses et psychose

    HeartlandIl y a 4 jours

    CBD et chats

    HeartlandIl y a 5 jours

    Je me demandais si quelqu'un avait de l'expérience avec Sonoma CBD Supply, et s'il était digne de confiance ou non?

    HeartlandIl y a 4 jours

    Industriel Chanvre Tendances récentes du marché, demande, défis et opportunités avec la taille de l'industrie…

    HeartlandIl y a 3 jours

    Collecte et stockage du pollen de cannabis

    HeartlandIl y a 2 jours

    Fermeture du magasin de chaussures DSW au centre commercial Watertown

    HeartlandIl y a 7 heures

    ...

    HeartlandIl y a 5 jours

    Chanvre passe de zéro à héros économique

    MétalIl y a 4 jours

    Primetals et Midrex fourniront la plus grande usine HBI au monde à Mikhailovsky HBI

    HeartlandIl y a 4 jours

    Field Trip Health annonce une augmentation de l'offre publique d'achat annoncée précédemment

    MétalIl y a 4 jours

    Les exportations américaines d'OCTG en baisse de 10.9% en décembre

    HeartlandIl y a 4 jours

    Patrimoine cannabis Présente ses résultats financiers de fin d'année 2020

    Tendance

    A Cloud Nine Capital Entity Copyright © 2020 - Tous droits réservés Fièrement fabriqué en Amérique